Effects of strong promoters on the plasmid replication and SP6 promoter study

Abstract

Strong T7 promoters are lethal to E. coli cells in the presence of large amounts of T7 RNA polymerase. The combination of SP6 promoter-SP6 RNA polymerase is also stressful to E. coli cells. The instability of strong promoter-RNA polymerase combination is said to be the effect of a NTP sink. However it can be also explained by plasmid loss due to inhibition of plasmid replication. Promoters oriented in the opposite direction of replication origin of ColEl-type plasmid, reduce the copy numbers of the plasmid in the presence of appropriate RNA polymerase. However a transcription termination signal relieves the copy number reduction, probably, by inhibiting the production of long RNA transcripts containing RNA I sequence at the 3`` end. Copy number of pGEM4Z which containing a SP6 promoter against ori was reduced to 80, and pGEM4ZS with a terminator down-stream the SP6 promoter was reduced to 290 in E. coli JM109 (pACSP6R) from 400. SP6 promoter has consensus sequence of ATTTAGGTGACACTATAGAAGA from -17 to +5. It is suggested that the region from -17 to -4 is binding domain and -3 to +5 is initiation domain. The importance of several positions was determined by cloning of randomly mutated SP6 promoter. The single point mutations, a G to A substitution at -11 and a T to C at -2 significantly reduced the the promoter activity to 15%. The single substitution of a T to G at -14 and -4, and a G to T at +1 also lead to the reduction of promoter activity to 21-22%. The single base substitutions of a A to T at -8, a C to T at -7, a T to A at -2 and a C to A at -5 retained about half of the promoter activity. The hierarchy of importance was partially determined as -11, -2 ＞ -14, -4, +1 ＞ -8, -7, -5, -9 ＞ -12, -10.